Tatd family hydrolase

Author: kkbz

August undefined, 2024

Websystem.number,seqid,system,target.name,hmm.accession,hmm.name,protein.name,full.seq.E.value,domain.iE.value,target.coverage,hmm.coverage,start,end,strand,target ... http://cplm.biocuckoo.org/show.php?entry=vVDoCSei2aUe0yVxycQ&id=31351

Hydrolase protein (Echinicola vietnamensis) - STRING interaction …

WebAffiliation 1 Department of Medical Biochemistry and Biophysics and Stockholm Bioinformatics Centre, Karolinska Institutet, Sweden. WebHydrolase, TatD family Imported. Gene names. Name. tatD Imported. Ordered locus names. MBOVPG45_0059 Imported. Organism names. Organism. Mycoplasmopsis bovis (strain … boots eye test appointments

RCSB PDB - 3IPW: Crystal structure of hydrolase TatD family …

WebNodes: Network nodes represent proteins WebMar 21, 2024 · TATDN2 (TatD DNase Domain Containing 2) is a Protein Coding gene. Among its related pathways are Unfolded Protein Response (UPR) and Cellular responses … WebFamily Assignments. Domains Proteins SCOP Link Families; 51: 51: SCOP 52686: ABC transporter ATPase domain-like hatfield tools

Biotechnological Applications of Bacterial GGTs

Tatd family hydrolase

Structure and function of TatD exonuclease in DNA repair

WebAdvances in Image-Guided e d = vii v [ Joseph C. Liao Li-Ming Su Editors A Springer Advances in Image-Guided Urologic Surgery Joseph C. Liao ° Li-Ming Su Editors Advances in Imag WebTatD, a member of this family has been shown experimentally to be a DNase enzyme. Literature references. Holm L, Sander C; , Proteins 1997;28:72-82.: An evolutionary …

Did you know?

WebPlease cite: Gough, J., Karplus, K., Hughey, R. and Chothia, C. (2001). "Assignment of Homology to Genome Sequences using a Library of Hidden Markov Models that ... WebMar 21, 2024 · GeneCards Summary for TATDN3 Gene. TATDN3 (TatD DNase Domain Containing 3) is a Protein Coding gene. Gene Ontology (GO) annotations related to this …

WebAug 18, 2009 · Crystal structure of hydrolase TatD family protein from Entamoeba histolytica. PDB DOI: 10.2210/pdb3IPW/pdb. Classification: HYDROLASE. Organism (s): … WebMETAL 112 112 Divalent metal cation 1 (By similarity). METAL 112 112 Divalent metal cation 2 (By similarity). METAL 149 149 Divalent metal cation 2 (By similarity).

WebMode: Single Entry to Database From: KEGG GENOME T00010 To: KEGG GENES Hits: 4420 from 1 database Items: 1 to 1000 of 4420 « First < Prev Web>PA_44_1_L1:asmbl_1441 (mannose-6-phosphate isomerase, class I) ATGAAACGCCTGACCGGAACGGTTCGGACGTACTCCTGGGGCTCCTACGATGCGATCCCAGACATCCTCG …

WebTatD family hydrolase. Gene provides a unified query environment for genes defined by sequence and/or in NCBI's Map Viewer. MGA_RS04010 TatD family hydrolase [] Gene ID: …

WebGene "Gene description" Evidence A1CF "APOBEC1 complementation factor" "Evidence at protein level" A4GALT "Alpha 1,4-galactosyltransferase (P blood group)" "Evidence at protein le hatfield to old streetWebDetails Name Hydrolase, TatD family Kind protein Organism Thermotoga maritima (strain ATCC 43589 / MSB8 / DSM 3109 / JCM 10099) Protein boots eye test halifaxWebGamma-glutamyl transpeptidase (GGT) enzyme is ubiquitously present in all life forms and plays a variety of roles in diverse organisms. Higher eukaryotes mainly utilize GGT for glutathione degradation, and mammalian GGTs have implications in many physiological disorders also. GGTs from unicellular prokaryotes serve different physiological functions … hatfield to st albans bus timetableWebHydrolase, TatD family; KEGG: pca:Pcar_1695 Mg-dependent DNase; TIGRFAM: hydrolase, TatD family; PFAM: TatD-related deoxyribonuclease (261 aa) Predicted Functional … hatfield to stansted airportWebName: Hydrolase, TatD family: Synonyms: Uncharacterized protein; Gene Name: None: Organism: Thermotoga maritima (strain ATCC 43589 / MSB8 / DSM 3109 / JCM 10099) boots eye tests costhttp://sybil-clovr.igs.umaryland.edu/sybil/current/cgi/shared/make_multifasta.cgi?site=MogensKilian_12Pacnes_sybil&genomic_sequence_ids=48343&seq_type=trans&filename=sequence_48343_gene_models.fsa&doctype=1 boots eye test cost 2023Web(GenBank) TatD family hydrolase. KO: K03424 : TatD DNase family protein [EC:3.1.21.-] Organism: cmor Caldicellulosiruptor morganii. Brite: KEGG Orthology (KO) … hatfield to st albans